Human CDSN(Corneodesmosin) ELISA Kit

Human CDSN(Corneodesmosin) ELISA Kit

Contact us: [email protected]

Human Corneodesmosin (CDSN) ELISA Kit

RDR-CDSN-Hu-48Tests 48 Tests
EUR 544

Human Corneodesmosin (CDSN) ELISA Kit

RDR-CDSN-Hu-96Tests 96 Tests
EUR 756

Human Corneodesmosin, CDSN ELISA KIT

ELI-33835h 96 Tests
EUR 824

Human Corneodesmosin (CDSN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Corneodesmosin (CDSN) ELISA Kit

abx252173-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Corneodesmosin (CDSN) ELISA Kit

SEC369Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit

SEC369Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit

SEC369Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit

SEC369Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corneodesmosin (CDSN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corneodesmosin (CDSN) in tissue homogenates, cell lysates and other biological fluids.

Human Corneodesmosin (CDSN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corneodesmosin elisa. Alternative names of the recognized antigen: HTSS
  • S protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Corneodesmosin (CDSN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Corneodesmosin ELISA Kit (CDSN)

RK01084 96 Tests
EUR 521

Pig Corneodesmosin (CDSN) ELISA Kit

abx360692-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Corneodesmosin (CDSN) ELISA Kit

abx363465-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Porcine Corneodesmosin, CDSN ELISA KIT

ELI-33142p 96 Tests
EUR 928

Mouse Corneodesmosin, Cdsn ELISA KIT

ELI-49923m 96 Tests
EUR 865

Monkey Corneodesmosin (CDSN) ELISA Kit

abx358695-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Corneodesmosin (CDSN) ELISA Kit

abx355647-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Corneodesmosin (CDSN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody

abx432488-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Corneodesmosin (CDSN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Corneodesmosin (CDSN)

  • EUR 341.92
  • EUR 194.00
  • EUR 1007.20
  • EUR 402.40
  • EUR 704.80
  • EUR 292.00
  • EUR 2368.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15517
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.5kDa
  • Isoelectric Point: 7.8
Description: Recombinant Human Corneodesmosin expressed in: E.coli

ELISA kit for Human CDSN (Corneodesmosin)

ELK5202 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Corneodesmosin (CDSN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Corneodesmos
  • Show more
Description: A sandwich ELISA kit for detection of Corneodesmosin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human CDSN (Corneodesmosin)

E-EL-H1497 1 plate of 96 wells
EUR 534
  • Gentaur's CDSN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CDSN. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CDSN (Corneodesmosin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Corneodesmosin (CDSN)

KTE62425-48T 48T
EUR 332
  • Corneodesmosin is a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Corneodesmosin (CDSN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Corneodesmosin (CDSN)

KTE62425-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Corneodesmosin is a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Corneodesmosin (CDSN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Corneodesmosin (CDSN)

KTE62425-96T 96T
EUR 539
  • Corneodesmosin is a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. During maturation of the cornified layers, the protein undergoes a series of cleavages, which are thought to be required
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Corneodesmosin (CDSN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Corneodesmosin (CDSN) CLIA Kit

abx196565-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Corneodesmosin (CDSN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Corneodesmosin (CDSN) Protein

  • EUR 495.00
  • EUR 244.00
  • EUR 1372.00
  • EUR 565.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Corneodesmosin (CDSN) ELISA Kit

abx357640-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cdsn ELISA Kit| Mouse Corneodesmosin ELISA Kit

EF014547 96 Tests
EUR 689

Corneodesmosin (CDSN) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Corneodesmosin (CDSN) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CLIA kit for Human CDSN (Corneodesmosin)

E-CL-H0965 1 plate of 96 wells
EUR 584
  • Gentaur's CDSN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CDSN . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CDSN (Corneodesmosin) in samples from Serum, Plasma, Cell supernatant

Corneodesmosin (CDSN) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN)

Recombinant Human Corneodesmosin/CDSN (C-6His)

C590-10ug 10ug
EUR 121
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Corneodesmosin/CDSN (C-6His)

C590-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Corneodesmosin/CDSN (C-6His)

C590-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Corneodesmosin/CDSN (C-6His)

C590-50ug 50ug
EUR 263
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with APC.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with Biotin.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with Cy3.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with FITC.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with HRP.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with PE.

Corneodesmosin (CDSN) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys33~Gly300
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corneodesmosin (CDSN). This antibody is labeled with APC-Cy7.

Human Corneodesmosin ELISA kit

E01C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Corneodesmosin ELISA kit

E01C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Corneodesmosin ELISA kit

E01C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


EHC0413 96Tests
EUR 521


EF006683 96 Tests
EUR 689

Goat Corneodesmosin ELISA kit

E06C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Corneodesmosin ELISA kit

E06C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Corneodesmosin ELISA kit

E06C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corneodesmosin ELISA kit

E02C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corneodesmosin ELISA kit

E02C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corneodesmosin ELISA kit

E02C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Corneodesmosin ELISA kit

E03C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Corneodesmosin ELISA kit

E03C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Corneodesmosin ELISA kit

E03C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corneodesmosin ELISA kit

E04C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corneodesmosin ELISA kit

E04C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Corneodesmosin ELISA kit

E04C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Corneodesmosin ELISA kit

E07C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Corneodesmosin ELISA kit

E07C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Corneodesmosin ELISA kit

E07C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Corneodesmosin ELISA kit

E08C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Corneodesmosin ELISA kit

E08C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Corneodesmosin ELISA kit

E08C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Corneodesmosin ELISA kit

E09C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Corneodesmosin ELISA kit

E09C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Corneodesmosin ELISA kit

E09C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDSN ELISA Kit (Human) (OKAN06160)

OKAN06160 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

CDSN ELISA Kit (Human) (OKCD08104)

OKCD08104 96 Wells
EUR 975
Description: Description of target: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

CDSN ELISA Kit (Human) (OKDD00180)

OKDD00180 96 Wells
EUR 975
Description: Description of target: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.038 ng/mL


EGTC0413 96Tests
EUR 521


ECC0413 96Tests
EUR 521

Chicken CDSN ELISA Kit

ECKC0413 96Tests
EUR 521


EBC0413 96Tests
EUR 521

Anserini CDSN ELISA Kit

EAC0413 96Tests
EUR 521

Porcine CDSN ELISA Kit

EPC0413 96Tests
EUR 521


ERC0413 96Tests
EUR 521


ERTC0413 96Tests
EUR 521


ESC0413 96Tests
EUR 521


EMC0413 96Tests
EUR 521


EMKC0413 96Tests
EUR 521

Guinea pig Corneodesmosin ELISA kit

E05C0406-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Corneodesmosin ELISA kit

E05C0406-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Corneodesmosin ELISA kit

E05C0406-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Corneodesmosin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig CDSN ELISA Kit

EGC0413 96Tests
EUR 521


YF-PA23430 50 ul
EUR 334
Description: Mouse polyclonal to Corneodesmosin


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDSN antibody

70R-16342 50 ul
EUR 435
Description: Rabbit polyclonal CDSN antibody

CDSN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CDSN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human CDSN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDSN Recombinant Protein (Human)

RP006709 100 ug Ask for price

Corneodesmosin (CDS2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Corneodesmosin (CDS2) Antibody

abx231570-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-Corneodesmosin (5B4)

YF-MA12395 100 ug
EUR 363
Description: Mouse monoclonal to Corneodesmosin

Anti-Corneodesmosin (6F11)

YF-MA10154 100 ug
EUR 363
Description: Mouse monoclonal to Corneodesmosin

CDSN cloning plasmid

CSB-CL005124HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgggctcgtctcgggcaccctggatggggcgtgtgggtgggcacgggatgttggcactgctgctggctggtctcctcctgccagggaccttggctaagagcattggcaccttctcagacccctgtaaggaccccacgcgtatcacctcccctaacgacccctgcctcactggga
  • Show more
Description: A cloning plasmid for the CDSN gene.

CDSN Rabbit pAb

A14568-100ul 100 ul
EUR 308

CDSN Rabbit pAb

A14568-200ul 200 ul
EUR 459

CDSN Rabbit pAb

A14568-20ul 20 ul
EUR 183

CDSN Rabbit pAb

A14568-50ul 50 ul
EUR 223

CDSN Rabbit pAb

A14602-100ul 100 ul
EUR 308

CDSN Rabbit pAb

A14602-200ul 200 ul
EUR 459

CDSN Rabbit pAb

A14602-20ul 20 ul
EUR 183

CDSN Rabbit pAb

A14602-50ul 50 ul
EUR 223

CDSN Polyclonal Antibody

28623-100ul 100ul
EUR 252

CDSN Polyclonal Antibody

28623-50ul 50ul
EUR 187

CDSN Polyclonal Antibody

28643-100ul 100ul
EUR 252

CDSN Polyclonal Antibody

28643-50ul 50ul
EUR 187

Anti-CDSN antibody

STJ72420 100 µg
EUR 359

Anti-CDSN antibody

STJ116779 100 µl
EUR 277
Description: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.

Anti-CDSN antibody

STJ116812 100 µl
EUR 277
Description: This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6.

CDSN ORF Vector (Human) (pORF)

ORF002237 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

CDSN Polyclonal Conjugated Antibody

C28623 100ul
EUR 397

CDSN Polyclonal Conjugated Antibody

C28643 100ul
EUR 397

Mouse CDSN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDSN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDSN Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CDSN Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDSN. Recognizes CDSN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CDSN Recombinant Protein (Mouse)

RP123242 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

CDSN sgRNA CRISPR Lentivector set (Human)

K0423101 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Polyclonal CDSN Antibody (internal region)

APR15378G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CDSN (internal region). This antibody is tested and proven to work in the following applications:

Cdsn ORF Vector (Mouse) (pORF)

ORF041082 1.0 ug DNA
EUR 506

CDSN sgRNA CRISPR Lentivector (Human) (Target 1)

K0423102 1.0 ug DNA
EUR 154

CDSN sgRNA CRISPR Lentivector (Human) (Target 2)

K0423103 1.0 ug DNA
EUR 154

CDSN sgRNA CRISPR Lentivector (Human) (Target 3)

K0423104 1.0 ug DNA
EUR 154

CDSN Protein Vector (Human) (pPB-C-His)

PV008945 500 ng
EUR 329

CDSN Protein Vector (Human) (pPB-N-His)

PV008946 500 ng
EUR 329

CDSN Protein Vector (Human) (pPM-C-HA)

PV008947 500 ng
EUR 329

CDSN Protein Vector (Human) (pPM-C-His)

PV008948 500 ng
EUR 329

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Cdsn sgRNA CRISPR Lentivector set (Mouse)

K3895101 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Monoclonal CDSN Antibody (monoclonal) (M01), Clone: 6F11

APR15379G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CDSN (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6F11. This antibody is applicable in WB, E

Cdsn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3895102 1.0 ug DNA
EUR 154

Cdsn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3895103 1.0 ug DNA
EUR 154

Cdsn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3895104 1.0 ug DNA
EUR 154

CDSN Protein Vector (Mouse) (pPB-C-His)

PV164326 500 ng
EUR 603

CDSN Protein Vector (Mouse) (pPB-N-His)

PV164327 500 ng
EUR 603

CDSN Protein Vector (Mouse) (pPM-C-HA)

PV164328 500 ng
EUR 603

CDSN Protein Vector (Mouse) (pPM-C-His)

PV164329 500 ng
EUR 603

Cdsn 3'UTR GFP Stable Cell Line

TU153666 1.0 ml Ask for price

CDSN 3'UTR Luciferase Stable Cell Line

TU004121 1.0 ml
EUR 1394

Cdsn 3'UTR Luciferase Stable Cell Line

TU103666 1.0 ml Ask for price

CDSN 3'UTR GFP Stable Cell Line

TU054121 1.0 ml
EUR 1394

Human CDSN(Corneodesmosin) ELISA Kit