Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit
Contact us: [email protected]
 ELISA Kit) Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
RDR-RAB7A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
RDR-RAB7A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
 Antibody) RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
20-abx127026 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
abx117042-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
abx122528-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
20-abx000788 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
20-abx001068 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
abx237043-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody |
|
20-abx302116 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
20-abx156866 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
) Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A) |
|
RK02178 |
Abclonal |
96 Tests |
EUR 521 |
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
SEK300Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids. |
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
SEK300Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids. |
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
SEK300Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids. |
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
SEK300Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids. |
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit |
|
4-SEK300Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7
- Ras-related protein Rab-7a
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 CLIA Kit) Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit |
|
20-abx495849 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Antibody (HRP)) RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP) |
|
20-abx314287 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC) |
|
20-abx314288 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin) |
|
20-abx314289 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family) |
|
ELK5152 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
- Show more
|
|
Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 RAB7A, Member RAS Oncogene Family Protein |
|
20-abx260842 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Recombinant Human RAB7A, Member RAS Oncogene Family |
|
7-06004 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human RAB7A, Member RAS Oncogene Family |
|
7-06005 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human RAB7A, Member RAS Oncogene Family |
|
7-06006 |
CHI Scientific |
1mg |
Ask for price |
 RAB7A, Member RAS Oncogene Family Human Recombinant Protein |
|
PROTP51149 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: RAB7A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (1-207a.a.) and having a molecular mass of 25.6kDa.;RAB7A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
 RAB7A siRNA |
|
20-abx904434 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB7A siRNA |
|
20-abx930704 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB7A siRNA |
|
20-abx930705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RAB7A antibody |
|
38205-100ul |
SAB |
100ul |
EUR 252 |
 RAB7A Antibody |
|
DF6288 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RAB7A Antibody detects endogenous levels of total RAB7A. |
RAB7A Antibody |
|
CSB-PA019219KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
|
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
RAB7A Antibody |
|
CSB-PA019219KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
|
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
RAB7A Antibody |
|
1-CSB-PA019219LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 anti-RAB7A |
|
YF-PA15488 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to RAB7A |
 Human RAB7A/ Ras-related protein Rab-7a ELISA Kit |
|
E2947Hu |
Sunlong |
1 Kit |
EUR 605 |
 Human Ras- related protein Rab- 7a, RAB7A ELISA KIT |
|
ELI-36110h |
Lifescience Market |
96 Tests |
EUR 824 |
 (OKCD02032)) RAB7A ELISA Kit (Human) (OKCD02032) |
|
OKCD02032 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL |
 (OKEH08041)) RAB7A ELISA Kit (Human) (OKEH08041) |
|
OKEH08041 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23ng/mL |
 Rabbit Ras- related protein Rab- 7a, RAB7A ELISA KIT |
|
ELI-18192Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 Bovine Ras- related protein Rab- 7a, RAB7A ELISA KIT |
|
ELI-22150b |
Lifescience Market |
96 Tests |
EUR 928 |
 Mouse Ras- related protein Rab- 7a, Rab7a ELISA KIT |
|
ELI-30429m |
Lifescience Market |
96 Tests |
EUR 865 |
 RAB7A Conjugated Antibody |
|
C38205 |
SAB |
100ul |
EUR 397 |
 RAB7A cloning plasmid |
|
CSB-CL019219HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 696
- Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg
- Show more
|
|
Description: A cloning plasmid for the RAB7A gene. |
 anti- RAB7A antibody |
|
FNab07043 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: RAB7A, member RAS oncogene family
- Uniprot ID: P51149
- Gene ID: 7879
- Research Area: Signal Transduction
|
|
Description: Antibody raised against RAB7A |
 RAB7A Rabbit pAb |
|
A1154-100ul |
Abclonal |
100 ul |
EUR 308 |
RAB7A Rabbit pAb |
|
A1154-200ul |
Abclonal |
200 ul |
EUR 459 |
RAB7A Rabbit pAb |
|
A1154-20ul |
Abclonal |
20 ul |
EUR 183 |
RAB7A Rabbit pAb |
|
A1154-50ul |
Abclonal |
50 ul |
EUR 223 |
RAB7A Rabbit pAb |
|
A12344-100ul |
Abclonal |
100 ul |
EUR 308 |
RAB7A Rabbit pAb |
|
A12344-200ul |
Abclonal |
200 ul |
EUR 459 |
RAB7A Rabbit pAb |
|
A12344-20ul |
Abclonal |
20 ul |
Ask for price |
RAB7A Rabbit pAb |
|
A12344-50ul |
Abclonal |
50 ul |
Ask for price |
RAB7A Rabbit pAb |
|
A12784-100ul |
Abclonal |
100 ul |
EUR 308 |
RAB7A Rabbit pAb |
|
A12784-200ul |
Abclonal |
200 ul |
EUR 459 |
RAB7A Rabbit pAb |
|
A12784-20ul |
Abclonal |
20 ul |
EUR 183 |
RAB7A Rabbit pAb |
|
A12784-50ul |
Abclonal |
50 ul |
EUR 223 |
 RAB7A Blocking Peptide |
|
DF6288-BP |
Affbiotech |
1mg |
EUR 195 |
 Anti-RAB7A antibody |
|
STJ25267 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. |
Anti-RAB7A antibody |
|
STJ114224 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. |
Anti-RAB7A antibody |
|
STJ114654 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. |
 Anti-Rab7a antibody |
|
STJ140063 |
St John's Laboratory |
150 µg |
EUR 231 |
|
Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification). |
 Human RAB7A shRNA Plasmid |
|
20-abx955306 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RAB7A Recombinant Protein (Human) |
|
RP025543 |
ABM |
100 ug |
Ask for price |
 ELISA Kit) Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
20-abx585081 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 ELISA Kit) Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
20-abx152910 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
20-abx152911 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
20-abx152912 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human RAB27B, Member RAS Oncogene Family (RAB27B) ELISA Kit |
|
20-abx382610 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
20-abx382639 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 ELISA Kit) Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
20-abx258183 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
DLR-RAB1A-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
DLR-RAB1A-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
DLR-RAB37-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
DLR-RAB37-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
DLR-RAB5A-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
DLR-RAB5A-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
DLR-RAB5C-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
DLR-RAB5C-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
DLR-RAB8B-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
DLR-RAB8B-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
RD-RAB1A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
RD-RAB1A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
RD-RAB37-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
RD-RAB37-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
RD-RAB5A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
RD-RAB5A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
RD-RAB5C-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
RD-RAB5C-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
RD-RAB8B-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
RD-RAB8B-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
RDR-RAB1A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
RDR-RAB1A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
RDR-RAB37-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
RDR-RAB37-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
RDR-RAB5A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
RDR-RAB5A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
RDR-RAB5C-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
RDR-RAB5C-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
RDR-RAB8B-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit |
|
RDR-RAB8B-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
ELISA Kit) Human RAB5A, Member RAS Oncogene Family(RAB5A)ELISA Kit |
|
QY-E04663 |
Qayee Biotechnology |
96T |
EUR 361 |
 ELISA Kit) Human RAB37, Member RAS Oncogene Family(RAB37) ELISA Kit |
|
QY-E04664 |
Qayee Biotechnology |
96T |
EUR 361 |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
SEJ783Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
SEJ783Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
SEJ783Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
SEJ783Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids. |
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit |
|
4-SEJ783Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
- YPT1
- Ras-related protein Rab-1A
- YPT1-related protein
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
SEK305Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
SEK305Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
SEK305Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
SEK305Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids. |
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit |
|
4-SEK305Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB5A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB5
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
SEM679Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
SEM679Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
SEM679Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
SEM679Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids. |
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit |
|
4-SEM679Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB37, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: Ras-related protein Rab-37
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
SEP757Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
SEP757Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
SEP757Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
SEP757Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-A
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids. |
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit |
|
4-SEP757Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL
- RAB5CL
- Ras-related protein Rab-5C
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Rab10, Member Ras Oncogene Family Antibody |
|
20-abx114958 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Rab11A, Member Ras Oncogene Family Antibody |
|
20-abx114961 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit
