Human PCDH20(Protocadherin 20) ELISA Kit

Human PCDH20(Protocadherin 20) ELISA Kit

Contact us: [email protected]

Human Protocadherin 20(PCDH20)ELISA Kit

QY-E00384 96T
EUR 394

Human Protocadherin 20 (PCDH20) ELISA Kit

SEE100Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit

SEE100Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit

SEE100Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit

SEE100Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protocadherin 20 elisa. Alternative names of the recognized antigen: PCDH13
  • Protocadherin-13
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 20 (PCDH20) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Protocadherin 20 (PCDH20) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protocadherin 20 (PCDH20) Antibody

abx122071-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody

abx026367-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody

abx026367-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protocadherin 20 (PCDH20) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Protocadherin 20 (PCDH20)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8N6Y1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Protocadherin 20 expressed in: E.coli

Mouse Protocadherin- 20, Pcdh20 ELISA KIT

ELI-45080m 96 Tests
EUR 865

Human Protocadherin 20 (PCDH20) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Protocadherin 20 (PCDH20) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PCDH20 (Protocadherin 20)

ELK5031 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin 20 (PCDH20). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protocad
  • Show more
Description: A sandwich ELISA kit for detection of Protocadherin 20 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Protocadherin-20 (PCDH20)

KTE61298-48T 48T
EUR 332
  • Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protocadherin-20 (PCDH20)

KTE61298-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protocadherin-20 (PCDH20)

KTE61298-96T 96T
EUR 539
  • Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Protocadherin 20 (PCDH20) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20)

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with APC.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with Biotin.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with Cy3.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with FITC.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with HRP.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with PE.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with APC-Cy7.

PCDH20 ELISA Kit (Human) (OKCD00930)

OKCD00930 96 Wells
EUR 831
Description: Description of target: Potential calcium-dependent cell-adhesion protein. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.126 ng/mL

FGF-20, human recombinant

EUR 277

99445-20 DCT 20 X 150MM

99445-20 250/pk
EUR 119
Description: Disposable Culture Tubes; DCT's, CGW


N2028-20 20 mg
EUR 630
Description: Extracted from Pseudo-ginseng;Store the product in sealed, cool and dry condition


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCDH20 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCDH20. Recognizes PCDH20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200


YF-PA26579 50 ul
EUR 334
Description: Mouse polyclonal to PCDH20


N2192-20 20 mg
EUR 514
Description: Extracted from Panax ginseng C. A. Mey. dried roots;Store the product in sealed, cool and dry condition

20(R)Ginsenoside Rg2

N2195-20 20 mg
EUR 224
Description: Extracted from Panax ginseng C. A. Mey. dried roots;Store the product in sealed, cool and dry condition

20(R)Ginsenoside Rg3

N2198-20 20 mg
EUR 514
Description: Extracted from Panax ginseng C.A.Mey. roots;Store the product in sealed, cool and dry condition

Human Protocadherin 1 ELISA kit

E01P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin 1 ELISA kit

E01P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin 1 ELISA kit

E01P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

DiagNano Gold Nanoparticle Passive Conjugation Kit, 20 nm

GPK-20 1 kit
EUR 715

Human PCDH20 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IL-20(Interleukin 20) ELISA Kit

EH0190 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: Q9NYY1
  • Alias: IL-20/IL20/ZCYTO10/IL10D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human cytokeratin 20(CK-20)ELISA Kit

GA-E1735HM-48T 48T
EUR 289

Human cytokeratin 20(CK-20)ELISA Kit

GA-E1735HM-96T 96T
EUR 466

Human cytokeratin 20,CK-20 ELISA Kit

201-12-1719 96 tests
EUR 440
  • This cytokeratin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 20,IL-20 ELISA KIT

201-12-2164 96 tests
EUR 440
  • This Interleukin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 20(IL-20)ELISA Kit

CSB-E15015h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 20 (IL-20) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 20(IL-20)ELISA Kit

  • EUR 678.00
  • EUR 4644.00
  • EUR 2467.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 20(IL-20) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human cytokeratin 20,CK-20 ELISA Kit

CN-04600H1 96T
EUR 464

Human cytokeratin 20,CK-20 ELISA Kit

CN-04600H2 48T
EUR 313

Human Interleukin 20(IL-20)ELISA Kit

QY-E04295 96T
EUR 361

Human cytokeratin 20(CK-20)ELISA Kit

QY-E00973 96T
EUR 361


TF-20 1000/pk
EUR 418
Description: Filter Tip; Filter Tips Pipette - Axygen

ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 20 reactions)

EUR 718

PCDH20 Rabbit pAb

A10428-100ul 100 ul
EUR 308

PCDH20 Rabbit pAb

A10428-200ul 200 ul
EUR 459

PCDH20 Rabbit pAb

A10428-20ul 20 ul
EUR 183

PCDH20 Rabbit pAb

A10428-50ul 50 ul
EUR 223

PCDH20 Polyclonal Antibody

A66378 100 µg
EUR 570.55
Description: reagents widely cited

PCDH20 Polyclonal Antibody

27434-100ul 100ul
EUR 252

PCDH20 Polyclonal Antibody

27434-50ul 50ul
EUR 187

PCDH20 cloning plasmid

CSB-CL822719HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2775
  • Sequence: atggggcgtctacatcgtcccaggagcagcaccagctacaggaacctgccgcatctgtttctgtttttcctcttcgtgggacccttcagctgcctcgggagttacagccgggccaccgagcttctgtacagcctaaacgagggactacccgcgggggtgctcatcggcagcctgg
  • Show more
Description: A cloning plasmid for the PCDH20 gene.

Anti-PCDH20 antibody

STJ112460 100 µl
EUR 277
Description: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain.

Anti-PCDH20 (2C3)

YF-MA19261 100 ug
EUR 363
Description: Mouse monoclonal to PCDH20

Anti-PCDH20 (1B7)

YF-MA19262 100 ug
EUR 363
Description: Mouse monoclonal to PCDH20

Human Protocadherin-1 (PCDH1) ELISA Kit

abx517940-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Protocadherin β 2 ELISA kit

E01P0065-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin β 2 ELISA kit

E01P0065-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin β 2 ELISA kit

E01P0065-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protocadherin-1

EK3817 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protocadherin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PCDH1/ Protocadherin-1 ELISA Kit

E1870Hu 1 Kit
EUR 571

Human PCDH1(Protocadherin-1) ELISA Kit

EH1850 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q08174
  • Alias: PCDH1/Protocadherin-1/Cadherin-like protein 1/Protocadherin-42/PC42/PCDH42/protocadherin 42/Protocadherin-42/cadherin-like 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human PCDH15(Protocadherin 15) ELISA Kit

EH3515 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q96QU1
  • Alias: PCDH15/CDHR15/DFNB23/PCDH15/USH1F/autosomal recessive 23/cadherin-related family member 15/DKFZp667A1711/protocadherin-15/protocadherin-related 15
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protocadherin- 17, PCDH17 ELISA KIT

ELI-12385h 96 Tests
EUR 824

Human Protocadherin- 23, DCHS2 ELISA KIT

ELI-14603h 96 Tests
EUR 824

Human Protocadherin- 18, PCDH18 ELISA KIT

ELI-21159h 96 Tests
EUR 824

Human Protocadherin- 12, PCDH12 ELISA KIT

ELI-21514h 96 Tests
EUR 824

Human Protocadherin- 7, PCDH7 ELISA KIT

ELI-22678h 96 Tests
EUR 824

Human Protocadherin- 1, PCDH1 ELISA KIT

ELI-05280h 96 Tests
EUR 824

Human protocadherin 1(PCDH1)ELISA Kit

GA-E0251HM-48T 48T
EUR 289

Human protocadherin 1(PCDH1)ELISA Kit

GA-E0251HM-96T 96T
EUR 466

Human Protocadherin- 8, PCDH8 ELISA KIT

ELI-35669h 96 Tests
EUR 824

Human Protocadherin- 15, PCDH15 ELISA KIT

ELI-37484h 96 Tests
EUR 824

Human Protocadherin- 9, PCDH9 ELISA KIT

ELI-37492h 96 Tests
EUR 824

Human Protocadherin- 16, DCHS1 ELISA KIT

ELI-43183h 96 Tests
EUR 824

Human Protocadherin- 10, PCDH10 ELISA KIT

ELI-45884h 96 Tests
EUR 824

Human Protocadherin- 19, PCDH19 ELISA KIT

ELI-45885h 96 Tests
EUR 824

Human Protocadherin 15 (PCDH15) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Protocadherin 9 (PCDH9) ELISA Kit

abx382086-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protocadherin 1 (PCDH1) ELISA Kit

abx251163-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Protocadherin 15 (PCDH15) ELISA Kit

abx252905-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human protocadherin 1,PCDH1 ELISA Kit

201-12-0235 96 tests
EUR 440
  • This protocadherin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit

DLR-PCDH15-Hu-48T 48T
EUR 517
  • Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit

DLR-PCDH15-Hu-96T 96T
EUR 673
  • Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protocadherin-10(PCDH10) ELISA kit

CSB-EL017525HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10 (PCDH10) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protocadherin-10(PCDH10) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10(PCDH10) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protocadherin-23(DCHS2) ELISA kit

CSB-EL006545HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23 (DCHS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protocadherin-23(DCHS2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23(DCHS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human protocadherin 1,PCDH1 ELISA Kit

CN-04176H1 96T
EUR 455

Human protocadherin 1,PCDH1 ELISA Kit

CN-04176H2 48T
EUR 304

Human Protocadherin 15 (PCDH15) ELISA Kit

RD-PCDH15-Hu-48Tests 48 Tests
EUR 521

Human Protocadherin 15 (PCDH15) ELISA Kit

RD-PCDH15-Hu-96Tests 96 Tests
EUR 723

Human Protocadherin 15 (PCDH15) ELISA Kit

RDR-PCDH15-Hu-48Tests 48 Tests
EUR 544

Human Protocadherin 15 (PCDH15) ELISA Kit

RDR-PCDH15-Hu-96Tests 96 Tests
EUR 756

Human Protocadherin 9(PCDH9)ELISA Kit

QY-E00380 96T
EUR 361

Human Protocadherin 8(PCDH8)ELISA Kit

QY-E00381 96T
EUR 361

Human Protocadherin 7(PCDH7)ELISA Kit

QY-E00382 96T
EUR 394

Human Protocadherin 21(PCDH21)ELISA Kit

QY-E00383 96T
EUR 394

Human Protocadherin 19(PCDH19)ELISA Kit

QY-E00385 96T
EUR 394

Human Protocadherin 18(PCDH18)ELISA Kit

QY-E00386 96T
EUR 394

Human Protocadherin 17(PCDH17)ELISA Kit

QY-E00387 96T
EUR 394

Human Protocadherin 12(PCDH12)ELISA Kit

QY-E00388 96T
EUR 394

Human Protocadherin 11(PCDH11)ELISA Kit

QY-E00389 96T
EUR 394

Human Protocadherin 10(PCDH10)ELISA Kit

QY-E00390 96T
EUR 361

Human protocadherin 1(PCDH1)ELISA Kit

QY-E00391 96T
EUR 361

Human Protocadherin 15 (PCDH15) ELISA Kit

SEE095Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit

SEE095Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit

SEE095Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit

SEE095Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protocadherin 15 elisa. Alternative names of the recognized antigen: USH1F
  • DFNB23
  • CDHR15
  • Deafness, Autosomal Recessive 23
  • Cadherin-Related Family Member 15
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 15 (PCDH15) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.


HGB20-20-GT 1/pk
EUR 97
Description: Lab Equipment; Axygen Branded EQ

Human CK-20/KRT20(Cytokeratin 20) ELISA Kit

EH2822 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35900
  • Alias: CK-20/KRT20/Protein IT/Cytokeratin-20(CK-20)/Keratin-20(K20)/Keratin, type I cytoskeletal 20
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human IL-20 (Interleukin 20)

E-EL-H0279 1 plate of 96 wells
EUR 534
  • Gentaur's IL-20 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-20. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-20 (Interleukin 20) in samples from Serum, Plasma, Cell supernatant

Human Matrix Metalloproteinase 20(MMP-20)ELISA Kit

QY-E02992 96T
EUR 361

TumorExoRNA? Tumor-derived exosome immunocapture and RNA extraction kit (20 reactions)

EUR 1219

PCDH20 ORF Vector (Human) (pORF)

ORF007560 1.0 ug DNA
EUR 95


HGB-20 1/pk
EUR 541
Description: Lab Equipment; Axygen Branded EQ

DiagNano Silica-Coated Gold Nanoparticles, 20 nm

CG-20 10mL
EUR 719

Rat Protocadherin 1 ELISA kit

E02P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protocadherin 1 ELISA kit

E02P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protocadherin 1 ELISA kit

E02P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protocadherin 1 ELISA kit

E03P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protocadherin 1 ELISA kit

E03P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protocadherin 1 ELISA kit

E03P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protocadherin 1 ELISA kit

E04P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protocadherin 1 ELISA kit

E04P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protocadherin 1 ELISA kit

E04P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protocadherin 1 ELISA kit

E06P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protocadherin 1 ELISA kit

E06P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protocadherin 1 ELISA kit

E06P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protocadherin 1 ELISA kit

E07P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protocadherin 1 ELISA kit

E07P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protocadherin 1 ELISA kit

E07P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protocadherin 1 ELISA kit

E08P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protocadherin 1 ELISA kit

E08P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protocadherin 1 ELISA kit

E08P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protocadherin 1 ELISA kit

E09P0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protocadherin 1 ELISA kit

E09P0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protocadherin 1 ELISA kit

E09P0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 20 ELISA kit

E01C0764-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 20 ELISA kit

E01C0764-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 20 ELISA kit

E01C0764-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 20 ELISA kit

E01I0013-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 20 ELISA kit

E01I0013-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 20 ELISA kit

E01I0013-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CK 20 ELISA Kit

EHC0771 96Tests
EUR 521

Human HSP-20 ELISA Kit

EHH0292 96Tests
EUR 521


EF000154 96 Tests
EUR 689

Human Keratin 20 ELISA Kit

ELA-E9127h 96 Tests
EUR 824

Cadherin-20 ELISA KIT|Human

EF008335 96 Tests
EUR 689

Human IL-20 ELISA Kit

LF-EK50865 1×96T
EUR 648

Human IL-20 ELISA Kit

RK00180 96 Tests
EUR 521

99447 DSSCT 20 X 125 W/ MARKING SPOT

99447-20 250/pk
EUR 211
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

DiagNano Silica-Coated PEGylated Gold Nanoparticles, 20 nm

PG-20 10mL
EUR 719

IL-20 ELISA Kit| Rat Interleukin 20 ELISA Kit

EF018189 96 Tests
EUR 689

Human Protocadherin alpha-1 (PCDHA1) ELISA Kit

abx516593-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human PCDH1 (Protocadherin 1)

E-EL-H2264 1 plate of 96 wells
EUR 534
  • Gentaur's PCDH1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH1 (Protocadherin 1) in samples from Serum, Plasma, Cell supernatant

Human PCDHA1/ Protocadherin alpha-1 ELISA Kit

E1871Hu 1 Kit
EUR 571

Human PCDHβ16(Protocadherin Beta 16) ELISA Kit

EH3516 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9NRJ7
  • Alias: PCDHβ16
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human PCDHγA2(Protocadherin Gamma A2) ELISA Kit

EH3518 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Y5H1
  • Alias: PCDHγA2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Protocadherin Fat 2, FAT2 ELISA KIT

ELI-09784h 96 Tests
EUR 824

Human Protocadherin Fat 3, FAT3 ELISA KIT

ELI-09785h 96 Tests
EUR 824

Human Protocadherin beta- 10, PCDHB10 ELISA KIT

ELI-12387h 96 Tests
EUR 824

Human Protocadherin gamma- A7, PCDHGA7 ELISA KIT

ELI-12388h 96 Tests
EUR 824

Human Protocadherin gamma- A12, PCDHGA12 ELISA KIT

ELI-12389h 96 Tests
EUR 824

Human Protocadherin alpha- 10, PCDHA10 ELISA KIT

ELI-14581h 96 Tests
EUR 824

Human Protocadherin beta- 15, PCDHB15 ELISA KIT

ELI-14582h 96 Tests
EUR 824

Human PCDH20(Protocadherin 20) ELISA Kit