Human DIABLO(Diablo Homolog) ELISA Kit

Human DIABLO(Diablo Homolog) ELISA Kit

Contact us: [email protected]

Human Diablo Homolog (DIABLO) ELISA Kit
DLR-DIABLO-Hu-96T 96T
EUR 673
  • Should the Human Diablo Homolog (DIABLO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diablo Homolog (DIABLO) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Diablo Homolog (DIABLO) ELISA Kit
RDR-DIABLO-Hu-48Tests 48 Tests
EUR 544
Human Diablo Homolog (DIABLO) ELISA Kit
RDR-DIABLO-Hu-96Tests 96 Tests
EUR 756
Human Diablo Homolog (DIABLO) ELISA Kit
RD-DIABLO-Hu-48Tests 48 Tests
EUR 521
Human Diablo Homolog (DIABLO) ELISA Kit
RD-DIABLO-Hu-96Tests 96 Tests
EUR 723
Human Diablo Homolog (DIABLO) ELISA Kit
20-abx151312
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.
Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.
Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.
Human Diablo Homolog (DIABLO) ELISA Kit
SEJ266Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diablo Homolog (DIABLO) in Tissue homogenates, cell lysates and other biological fluids.
Human Diablo Homolog (DIABLO) ELISA Kit
4-SEJ266Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC
  • DIABLO-S
  • Direct IAP-binding protein with low pI
  • Second mitochondria-derived activator of caspase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diablo Homolog (DIABLO) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Diablo Homolog ELISA Kit (DIABLO)
RK03615 96 Tests
EUR 521
Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.
Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.
Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.
Rat Diablo Homolog (DIABLO) ELISA Kit
SEJ266Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Diablo Homolog (DIABLO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Diablo Homolog (DIABLO) in tissue homogenates, cell lysates and other biological fluids.
Rat Diablo Homolog (DIABLO) ELISA Kit
4-SEJ266Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diablo Homolog elisa. Alternative names of the recognized antigen: SMAC
  • DIABLO-S
  • Direct IAP-binding protein with low pI
  • Second mitochondria-derived activator of caspase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Diablo Homolog (DIABLO) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Diablo Homolog (DIABLO) Antibody
20-abx176157
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Diablo Homolog (DIABLO) Antibody
20-abx176158
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Diablo Homolog (DIABLO) Antibody
20-abx212475
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diablo Homolog (DIABLO) Antibody
20-abx212504
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diablo Homolog (DIABLO) Antibody
20-abx112053
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Diablo Homolog (DIABLO) Antibody
20-abx172105
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Diablo Homolog (DIABLO) Antibody
20-abx172106
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Diablo Homolog (DIABLO) Antibody
20-abx333841
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Diablo homolog, mitochondrial, DIABLO ELISA KIT
ELI-25841h 96 Tests
EUR 824
ELISA kit for Human DIABLO (Diablo Homolog)
ELK4816 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom
  • Show more
Description: A sandwich ELISA kit for detection of Diablo Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Diablo Homolog (DIABLO) CLIA Kit
20-abx495657
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Diablo Homolog (DIABLO) Protein
20-abx653171
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Rat DIABLO (Diablo Homolog)
ELK7379 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diablo Homolog (DIABLO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diablo Hom
  • Show more
Description: A sandwich ELISA kit for detection of Diablo Homolog from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Mouse Diablo homolog, mitochondrial, Diablo ELISA KIT
ELI-48369m 96 Tests
EUR 865
Diablo Homolog (DIABLO) Antibody (HRP)
20-abx335325
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Diablo Homolog (DIABLO) Antibody (FITC)
20-abx335326
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Diablo Homolog (DIABLO) Antibody (Biotin)
20-abx335327
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat Diablo Homolog (DIABLO) Protein
20-abx653172
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Diablo homolog (DIABLO) polyclonal antibody
ABP-PAB-10267 100 ug Ask for price
    • Product line: Apoptosis
    • Brand:
ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)
KTE62061-48T 48T
EUR 332
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)
KTE62061-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Diablo homolog, mitochondrial (DIABLO)
KTE62061-96T 96T
EUR 539
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)
KTE71285-48T 48T
EUR 332
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)
KTE71285-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Diablo homolog, mitochondrial (DIABLO)
KTE71285-96T 96T
EUR 539
  • DIABLO encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Diablo homolog, mitochondrial (DIABLO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
DIABLO
E541-004 100ug
EUR 343
DIABLO ELISA KIT|Human
EF009108 96 Tests
EUR 689
DIABLO antibody
20R-1288 100 ug
EUR 377
Description: Rabbit polyclonal DIABLO antibody
Diablo antibody
20R-2899 100 ul
EUR 393
Description: Rabbit polyclonal Diablo antibody
DIABLO Antibody
31125-100ul 100ul
EUR 252
DIABLO Antibody
31125-50ul 50ul
EUR 187
DIABLO antibody
70R-16834 50 ul
EUR 435
Description: Rabbit polyclonal DIABLO antibody
DIABLO Antibody
32716-100ul 100ul
EUR 252
DIABLO Antibody
48991-100ul 100ul
EUR 333
DIABLO Antibody
48991-50ul 50ul
EUR 239
DIABLO Antibody
1-CSB-PA966330
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200
DIABLO Antibody
1-CSB-PA865113LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
DIABLO Antibody
DF7017 200ul
EUR 304
Description: DIABLO Antibody detects endogenous levels of total DIABLO.
DIABLO Antibody
1-CSB-PA592293
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300
DIABLO Antibody
1-CSB-PA006888GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
DIABLO antibody
70R-DR008 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal DIABLO antibody
DIABLO siRNA
20-abx914146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DIABLO siRNA
20-abx914147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DIABLO Antibody
ABD7017 100 ug
EUR 438
anti-DIABLO
YF-PA27589 50 ug
EUR 363
Description: Mouse polyclonal to DIABLO
Human Diablo/SMAC ELISA Kit
LF-EK50928 1×96T
EUR 648
DIABLO ELISA Kit (Human) (OKCD09174)
OKCD09174 96 Wells
EUR 975
Description: Description of target: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL
Human DIABLO Protein
abx060001-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.
Anserini Smac/DIABLO ELISA Kit
EAS0020 96Tests
EUR 521
DIABLO ELISA Kit (Rat) (OKCD04273)
OKCD04273 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL
ELISA kit for Human Diablo/SMAC
EK5376 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Diablo/SMAC in samples from serum, plasma, tissue homogenates and other biological fluids.
Human Diablo/SMAC PicoKine ELISA Kit
EK0838 96 wells
EUR 425
Description: For quantitative detection of human Diablo in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Diablo/SMAC ELISA Kit (Human) (OKBB00448)
OKBB00448 96 Wells
EUR 505
Description: Description of target: Diablo homolog, mitochondrial, also known as second mitochondria-derived activator of caspases (SMAC), is a protein that in humans is encoded by the DIABLO gene (direct IAP binding protein with low pI). It is mapped to 12q24.31. DIABLO can bind mammalian IAP homolog A (MIHA, or API3) and can also interact with MIHB, MIHC, and OpIAP, the baculoviral IAP. This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Over expression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL
DIABLO Rabbit pAb
A0853-100ul 100 ul
EUR 308
DIABLO Rabbit pAb
A0853-200ul 200 ul
EUR 459
DIABLO Rabbit pAb
A0853-20ul 20 ul Ask for price
DIABLO Rabbit pAb
A0853-50ul 50 ul Ask for price
DIABLO Rabbit pAb
A13432-100ul 100 ul
EUR 308
DIABLO Rabbit pAb
A13432-200ul 200 ul
EUR 459
DIABLO Rabbit pAb
A13432-20ul 20 ul
EUR 183
DIABLO Rabbit pAb
A13432-50ul 50 ul
EUR 223
DIABLO Blocking Peptide
33R-5520 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DIABLO antibody, catalog no. 20R-1288
Smac/DIABLO Antibody
3298-100
EUR 316
Smac/DIABLO Antibody
3298-30T
EUR 146
Smac/DIABLO Antibody
39330-100ul 100ul
EUR 390
DIABLO Blocking Peptide
DF7017-BP 1mg
EUR 195
Smac / DIABLO Antibody
abx037649-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
SMAC / DIABLO Antibody
20-abx137470
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
SMAC / DIABLO Protein
20-abx262000
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
DIABLO Conjugated Antibody
C48991 100ul
EUR 397
DIABLO Conjugated Antibody
C32716 100ul
EUR 397
DIABLO Conjugated Antibody
C31125 100ul
EUR 397
DIABLO cloning plasmid
CSB-CL865113HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 720
  • Sequence: atggcggctctgaagagttggctgtcgcgcagcgtaacttcattcttcaggtacagacagtgtttgtgtgttcctgttgtggctaactttaagaagcggtgtttctcagaattgataagaccatggcacaaaactgtgacgattggctttggagtaaccctgtgtgcggttcctat
  • Show more
Description: A cloning plasmid for the DIABLO gene.
DIABLO Rabbit pAb
A2564-100ul 100 ul
EUR 308
DIABLO Rabbit pAb
A2564-200ul 200 ul
EUR 459
DIABLO Rabbit pAb
A2564-20ul 20 ul
EUR 183
DIABLO Rabbit pAb
A2564-50ul 50 ul
EUR 223
anti- DIABLO antibody
FNab02384 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: diablo homolog(Drosophila)
  • Uniprot ID: Q9NR28
  • Gene ID: 56616
  • Research Area: Cancer
Description: Antibody raised against DIABLO
anti-Smac/Diablo
LF-PA0045 100 ul
EUR 334
Description: Rabbit polyclonal to Smac/Diablo
Anti-DIABLO antibody
PAab02384 100 ug
EUR 355
Anti-DIABLO antibody
STJ111037 100 µl
EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-DIABLO antibody
STJ115393 100 µl
EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-DIABLO antibody
STJ23380 100 µl
EUR 277
Description: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms.
anti-Smac / Diablo
YF-PA20009 50 ul
EUR 363
Description: Mouse polyclonal to Smac / Diablo
anti-Smac / Diablo
YF-PA20010 100 ug
EUR 403
Description: Rabbit polyclonal to Smac / Diablo
Recombinant Human SMAC/DIABLO
7-06409 5µg Ask for price
Recombinant Human SMAC/DIABLO
7-06410 20µg Ask for price
Recombinant Human SMAC/DIABLO
7-06411 1mg Ask for price
Human DIABLO shRNA Plasmid
20-abx961151
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DIABLO Recombinant Protein (Human)
RP009337 100 ug Ask for price
Smac/DIABLO Blocking Peptide
3298BP-50
EUR 153
DIABLO Antibody, HRP conjugated
1-CSB-PA865113LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DIABLO Antibody, FITC conjugated
1-CSB-PA865113LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DIABLO Antibody, Biotin conjugated
1-CSB-PA865113LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DIABLO. Recognizes DIABLO from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal Smac/DIABLO Antibody
APR00062G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Smac/DIABLO . This antibody is tested and proven to work in the following applications:
Anti-Smac/Diablo Antibody
A03790 100uL
EUR 432
Description: Rabbit Polyclonal Smac/Diablo Antibody. Validated in IP, WB and tested in Human.
Mouse DIABLO shRNA Plasmid
20-abx975688
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-Smac/Diablo Antibody
PB9860 100ug/vial
EUR 334
DIABLO Recombinant Protein (Rat)
RP198050 100 ug Ask for price
DIABLO Recombinant Protein (Mouse)
RP129032 100 ug Ask for price
Anti-Smac / Diablo (4F9)
YF-MA18960 50 ug
EUR 363
Description: Mouse monoclonal to Smac / Diablo
Anti-Smac / Diablo (4F9)
YF-MA18961 200 ul
EUR 363
Description: Mouse monoclonal to Smac / Diablo
DIABLO ORF Vector (Human) (pORF)
ORF003113 1.0 ug DNA
EUR 95
SMAC/DIABLO Human Recombinant Protein
PROTQ9NR28 Regular: 20ug
EUR 317
Description: Smac/Diablo Human Recombinant fused to N-terminal T7-Tag produced in E.Coli is a single, non-glycosylated polypeptide chain containing 199 amino acids and having a molecular mass of 22 kDa.
DIABLO sgRNA CRISPR Lentivector set (Human)
K0601901 3 x 1.0 ug
EUR 339
SMAC/Diablo protein (T7 tag)
80R-1058 100 ug
EUR 397
Description: Purified recombinant Human SMAC/Diablo protein (T7 tag)
Smac/Diablo recombinant monoclonal antibody
A5554 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Smac/Diablo for WB, IHC,ELISA
Diablo ORF Vector (Rat) (pORF)
ORF066018 1.0 ug DNA
EUR 506
Diablo ORF Vector (Mouse) (pORF)
ORF043012 1.0 ug DNA
EUR 506
DIABLO sgRNA CRISPR Lentivector (Human) (Target 1)
K0601902 1.0 ug DNA
EUR 154
DIABLO sgRNA CRISPR Lentivector (Human) (Target 2)
K0601903 1.0 ug DNA
EUR 154
DIABLO sgRNA CRISPR Lentivector (Human) (Target 3)
K0601904 1.0 ug DNA
EUR 154
DIABLO Protein Vector (Human) (pPB-C-His)
PV012449 500 ng
EUR 329
DIABLO Protein Vector (Human) (pPB-N-His)
PV012450 500 ng
EUR 329
DIABLO Protein Vector (Human) (pPM-C-HA)
PV012451 500 ng
EUR 329
DIABLO Protein Vector (Human) (pPM-C-His)
PV012452 500 ng
EUR 329
Monoclonal Smac/Diablo Antibody, Clone: Y12
APR10157G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Smac/Diablo. The antibodies are raised in Rabbit and are from clone Y12. This antibody is applicable in WB and IHC
Polyclonal DIABLO / SMAC Antibody (aa199-212)
APR07577G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DIABLO / SMAC (aa199-212). This antibody is tested and proven to work in the following applications:
Polyclonal DIABLO / SMAC Antibody (aa222-237)
APR07578G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DIABLO / SMAC (aa222-237). This antibody is tested and proven to work in the following applications:
Polyclonal DIABLO / SMAC Antibody (aa226-239)
APR07579G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DIABLO / SMAC (aa226-239). This antibody is tested and proven to work in the following applications:
Diablo sgRNA CRISPR Lentivector set (Rat)
K7604901 3 x 1.0 ug
EUR 339
Diablo sgRNA CRISPR Lentivector set (Mouse)
K4372501 3 x 1.0 ug
EUR 339
Anti-Smac/Diablo Rabbit Monoclonal Antibody
M03790 100ug/vial
EUR 397
Description: Rabbit Monoclonal Smac/Diablo Antibody. Validated in IP, IF and tested in Human, Mouse, Rat.
Recombinant Human SMAC/DIABLO Protein, Untagged, E.coli-1mg
QP13525-1mg 1mg
EUR 3655
Recombinant Human SMAC/DIABLO Protein, Untagged, E.coli-20ug
QP13525-20ug 20ug
EUR 201

Human DIABLO(Diablo Homolog) ELISA Kit