Human THBS3(Thrombospondin 3) ELISA Kit

Human THBS3(Thrombospondin 3) ELISA Kit

Contact us: [email protected]

Human Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Hu-96T 96T
EUR 673
  • Should the Human Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 3 (THBS3) in samples from plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Hu-48Tests 48 Tests
EUR 544
Human Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Hu-96Tests 96 Tests
EUR 756
Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-48Tests 48 Tests
EUR 521
Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-96Tests 96 Tests
EUR 723
Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-48T 48T
EUR 527
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-96T 96T
EUR 688
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-48Tests 48 Tests
EUR 557
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-96Tests 96 Tests
EUR 774
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-48Tests 48 Tests
EUR 533
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-96Tests 96 Tests
EUR 740
Human Thrombospondin 3 (THBS3) ELISA Kit
20-abx156876
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 3 (THBS3) ELISA Kit
abx259888-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Thrombospondin- 3, THBS3 ELISA KIT
ELI-36583h 96 Tests
EUR 824
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
20-abx154756
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Thrombospondin- 3, Thbs3 ELISA KIT
ELI-17025m 96 Tests
EUR 865
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.
ELISA kit for Human THBS3 (Thrombospondin 3)
ELK5166 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Thrombospondin 3 (THBS3) CLIA Kit
20-abx494398
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Thrombospondin-3 (Thbs3)
1-CSB-EP023489MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli
Mouse Thrombospondin-3 (Thbs3)
1-CSB-YP023489MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast
Thrombospondin 3 (THBS3) Antibody
20-abx178573
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Thrombospondin 3 (THBS3) Antibody
20-abx178574
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx110655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx110656
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx116967
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx123257
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx128997
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Thrombospondin 3 (THBS3) Antibody
abx030681-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
abx030681-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
abx238675-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx320416
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
abx431668-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Recombinant Thrombospondin 3 (THBS3)
4-RPD823Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49746
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli
Human Thrombospondin 3 (THBS3) Protein
20-abx166577
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Mouse THBS3 (Thrombospondin 3)
ELK6457 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Mouse Thrombospondin 3 (THBS3) CLIA Kit
20-abx494399
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106391
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106392
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109221
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109222
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Thrombospondin 3 (THBS3) Protein
20-abx655225
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Thrombospondin 3 (THBS3) Protein
20-abx655226
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human)
4-PAD823Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3)
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC
4-PAD823Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated
4-PAD823Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3
4-PAD823Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC
4-PAD823Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP
4-PAD823Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE
4-PAD823Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7
4-PAD823Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7.
Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus)
AMM08184G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications:
THBS3 ELISA Kit (Human) (OKCD00691)
OKCD00691 96 Wells
EUR 831
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL
Thrombospondin 3 ELISA KIT|Human
EF003592 96 Tests
EUR 689
Thbs3 ELISA Kit (Mouse) (OKCD01781)
OKCD01781 96 Wells
EUR 857
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 25.3 pg/mL
Human Thrombospondin 3 (TSP-3)ELISA Kit
201-12-2387 96 tests
EUR 440
  • This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Thrombospondin 3(TSP-3)ELISA Kit
QY-E00634 96T
EUR 361
THBS3 antibody
70R-21720 50 ul
EUR 435
Description: Rabbit polyclonal THBS3 antibody
Thbs3 Antibody
1-CSB-PA023489DA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
Thbs3 Antibody
1-CSB-PA023489EA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
THBS3 Antibody
1-CSB-PA023489ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
THBS3 Antibody
1-CSB-PA023489GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
THBS3 siRNA
20-abx936680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
THBS3 siRNA
20-abx936681
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human THBS3 shRNA Plasmid
20-abx954831
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
THBS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2368904 1.0 ug DNA
EUR 154
Human Thrombospondin 1 ELISA kit
E01T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1 ELISA kit
E01T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1 ELISA kit
E01T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin-2 ELISA kit
LF-EK50605 1×96T
EUR 648
THBS3 cloning plasmid
CSB-CL023489HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1458
  • Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT
  • Show more
Description: A cloning plasmid for the THBS3 gene.
Thbs3 Polyclonal Antibody
A57726 100 µg
EUR 570.55
Description: fast delivery possible
Thbs3 Polyclonal Antibody
A57777 100 µg
EUR 570.55
Description: Ask the seller for details
THBS3 Rabbit pAb
A3641-100ul 100 ul
EUR 308
THBS3 Rabbit pAb
A3641-200ul 200 ul
EUR 459
THBS3 Rabbit pAb
A3641-20ul 20 ul
EUR 183
THBS3 Rabbit pAb
A3641-50ul 50 ul
EUR 223
Anti-THBS3 antibody
STJ25845 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants.
Anti-THBS3 antibody
STJ71847 100 µg
EUR 359
FSH (Human Follicle-stimulating hormone) ELISA test
3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)
THBS3 ORF Vector (Human) (pORF)
ORF014707 1.0 ug DNA
EUR 354
Human Thrombospondin 1 (THBS1) ELISA Kit
DLR-THBS1-Hu-48T 48T
EUR 479
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.
Human Thrombospondin 1 (THBS1) ELISA Kit
DLR-THBS1-Hu-96T 96T
EUR 621
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.
Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-48T 48T
EUR 387
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-96T 96T
EUR 494
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 4 (THBS4) ELISA Kit
DLR-THBS4-Hu-48T 48T
EUR 517
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 4 (THBS4) ELISA Kit
DLR-THBS4-Hu-96T 96T
EUR 673
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.
Human Thrombospondin-2(THBS2) ELISA kit
CSB-EL023488HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Thrombospondin-2(THBS2) ELISA kit
1-CSB-EL023488HU
  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Thrombospondin-4(THBS4) ELISA kit
CSB-EL023490HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4 (THBS4) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Thrombospondin-4(THBS4) ELISA kit
1-CSB-EL023490HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4(THBS4) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin-2 (JAK2) ELISA Kit
abx050226-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
abx052577-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
20-abx153283
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 2 (THBS2) ELISA Kit
20-abx153284
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 4 (THBS4) ELISA Kit
20-abx153285
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 4 (THBS4) ELISA Kit
abx253753-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Human Thrombospondin 2 (THBS2) ELISA Kit
abx250162-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
abx253325-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Thrombospondin 4 (THBS4) ELISA Kit
abx253326-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human THBS1/ Thrombospondin-1 ELISA Kit
E2490Hu 1 Kit
EUR 537
Human THBS2/ Thrombospondin-2 ELISA Kit
E2491Hu 1 Kit
EUR 537
Human THBS4/ Thrombospondin-4 ELISA Kit
E2492Hu 1 Kit
EUR 571
Human THBS4(Thrombospondin-4) ELISA Kit
EH0795 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35443
  • Alias: TSP-4(Thrombospondin-4)/THBS4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Thrombospondin- 1, THBS1 ELISA KIT
ELI-02195h 96 Tests
EUR 824
Human Thrombospondin- 2, THBS2 ELISA KIT
ELI-06100h 96 Tests
EUR 824
Human Thrombospondin 4 (THBS4) ELISA Kit
abx571192-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
abx571959-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Thrombospondin 2 (THBS2) ELISA Kit
abx576059-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Thrombospondin-2 ELISA kit (4X96T)
LF-EK50606 4×96T
EUR 2201
Human Thrombospondin 1 (THBS1) ELISA Kit
RDR-THBS1-Hu-48Tests 48 Tests
EUR 500
Human Thrombospondin 1 (THBS1) ELISA Kit
RDR-THBS1-Hu-96Tests 96 Tests
EUR 692
Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-48Tests 48 Tests
EUR 390
Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-96Tests 96 Tests
EUR 536
Human Thrombospondin 4 (THBS4) ELISA Kit
RDR-THBS4-Hu-48Tests 48 Tests
EUR 544
Human Thrombospondin 4 (THBS4) ELISA Kit
RDR-THBS4-Hu-96Tests 96 Tests
EUR 756
Human Thrombospondin 1 ELISA Kit (THBS1)
RK02384 96 Tests
EUR 521
Human Thrombospondin 1 (THBS1) ELISA Kit
RD-THBS1-Hu-48Tests 48 Tests
EUR 478
Human Thrombospondin 1 (THBS1) ELISA Kit
RD-THBS1-Hu-96Tests 96 Tests
EUR 662
Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-48Tests 48 Tests
EUR 374
Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-96Tests 96 Tests
EUR 513
Human Thrombospondin 4 (THBS4) ELISA Kit
RD-THBS4-Hu-48Tests 48 Tests
EUR 521
Human Thrombospondin 4 (THBS4) ELISA Kit
RD-THBS4-Hu-96Tests 96 Tests
EUR 723
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-10x96wellstestplate 10x96-wells test plate
EUR 3147.61
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-1x48wellstestplate 1x48-wells test plate
EUR 346.86
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-1x96wellstestplate 1x96-wells test plate
EUR 452.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-5x96wellstestplate 5x96-wells test plate
EUR 1736.97
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
4-SED822Hu
  • EUR 3198.00
  • EUR 1687.00
  • EUR 453.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 2 elisa. Alternative names of the recognized antigen: TSP2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 2 (THBS2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Thrombospondin 4 (THBS4) ELISA Kit
SED824Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.
Human Thrombospondin 4 (THBS4) ELISA Kit
SED824Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human THBS3(Thrombospondin 3) ELISA Kit