Human RTN4R(Reticulon 4 Receptor) ELISA Kit

Human RTN4R(Reticulon 4 Receptor) ELISA Kit

Contact us: [email protected]

Human Reticulon 4 Receptor(RTN4R)ELISA Kit

QY-E01103 96T
EUR 361

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

SEF991Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 Receptor (RTN4R) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
  • Nogo-66 Receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 Receptor (RTN4R) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT

ELI-18409m 96 Tests
EUR 865

Human Reticulon 4 Receptor (RTN4R) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human RTN4R (Reticulon 4 Receptor)

ELK5164 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-48T 48T
EUR 332
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 receptor (RTN4R)

KTE60778-96T 96T
EUR 539
  • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RTN4R Reticulon 4 Receptor Human Recombinant Protein

PROTQ9BZR6 Regular: 10ug
EUR 317
Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

C632-10ug 10ug
EUR 121
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

C632-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

C632-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

C632-50ug 50ug
EUR 263
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

CM16-10ug 10ug
EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

CM16-1mg 1mg
EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

CM16-500ug 500ug
EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

CM16-50ug 50ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

CM42-10ug 10ug
EUR 126
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

CM42-1mg 1mg
EUR 1877
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

CM42-500ug 500ug
EUR 1328
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

CM42-50ug 50ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT

ELI-35842h 96 Tests
EUR 824

Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT

ELI-30455h 96 Tests
EUR 824

Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit

CSB-EL020576HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human RTN4(Reticulon 4) ELISA Kit

EH3732 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q9NQC3
  • Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Reticulon- 4, RTN4 ELISA KIT

ELI-52764h 96 Tests
EUR 824

Human Reticulon 4 (RTN4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Reticulon 4 (RTN4) ELISA Kit

abx253120-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Reticulon 4 (RTN4) ELISA Kit

DLR-RTN4-Hu-48T 48T
EUR 517
  • Should the Human Reticulon 4 (RTN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Reticulon 4 (RTN4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

DLR-RTN4-Hu-96T 96T
EUR 673
  • Should the Human Reticulon 4 (RTN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Reticulon 4 (RTN4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Reticulon-4(RTN4) ELISA kit

CSB-EL020572HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Reticulon-4(RTN4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Reticulon 4 ELISA Kit (RTN4)

RK02217 96 Tests
EUR 521

Human Reticulon 4 (RTN4) ELISA Kit

RD-RTN4-Hu-48Tests 48 Tests
EUR 521

Human Reticulon 4 (RTN4) ELISA Kit

RD-RTN4-Hu-96Tests 96 Tests
EUR 723

Human Reticulon 4 (RTN4) ELISA Kit

RDR-RTN4-Hu-48Tests 48 Tests
EUR 544

Human Reticulon 4 (RTN4) ELISA Kit

RDR-RTN4-Hu-96Tests 96 Tests
EUR 756

Human Reticulon 4(RTN4)ELISA Kit

QY-E01104 96T
EUR 361

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

SEF994Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

Human Reticulon 4 (RTN4) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP
  • ASY
  • NOGO
  • NSP-CL
  • RTN-X
  • Reticulon-5
  • Foocen
  • Neurite outgrowth inhibitor
  • Neuroendocrine-specific protein
  • Neuroendocrine-specific protein C homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant human Reticulon-4 receptor-like 2

P1411 100ug Ask for price
  • Uniprot ID: Q86UN3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4 receptor-like 2

Rtn4r/ Rat Rtn4r ELISA Kit

ELI-40942r 96 Tests
EUR 886

Recombinant human Reticulon-4

P1398 100ug Ask for price
  • Uniprot ID: Q9NQC3
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Reticulon-4

Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT

ELI-15500m 96 Tests
EUR 865

Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT

ELI-52476m 96 Tests
EUR 865

ELISA kit for Human RTN4 (Reticulon 4)

E-EL-H2535 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human RTN4 (Reticulon 4)

ELK4140 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT
  • Show more
Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)

KTE60779-48T 48T
EUR 332
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)

KTE60779-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulon-4 (RTN4)

KTE60779-96T 96T
EUR 539
  • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulon- 4, Rtn4 ELISA KIT

ELI-20214m 96 Tests
EUR 865

Rat RTN4(Reticulon 4) ELISA Kit

ER1312 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9JK11
  • Alias: RTN4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Mouse Reticulon 4 (RTN4) ELISA Kit

abx051861-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.

Mouse Reticulon 4 (RTN4) ELISA Kit

abx353194-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Reticulon 4 (RTN4) ELISA Kit

abx255978-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Reticulon 4 (RTN4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

abx122324-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

abx032462-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

abx032462-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RTN4 ELISA Kit| Rat Reticulon 4 ELISA Kit

EF018017 96 Tests
EUR 689

Human Reticulon 4 (RTN4) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse RTN4 (Reticulon 4)

E-EL-M1350 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat RTN4 (Reticulon 4)

E-EL-R1503 1 plate of 96 wells
EUR 534
  • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

Reticulon 4 (RTN4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

abx002254-50ul 50 ul
EUR 356
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulon 4 (RTN4) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulon 4 (RTN4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulon 4 (RTN4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Human 4-1BB Receptor Protein

PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Rat Reticulon 4 (RTN4) CLIA Kit

abx197645-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

RTN4R ELISA Kit (Human) (OKCD01887)

OKCD01887 96 Wells
EUR 831
Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.123 ng/mL

RTN4R ELISA Kit (Human) (OKCA02140)

OKCA02140 96 Wells
EUR 833
Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

CLIA kit for Rat RTN4 (Reticulon 4)

E-CL-R0748 1 plate of 96 wells
EUR 584
  • Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

Human RTN3(Reticulon-3) ELISA Kit

EH12024 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O95197
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Reticulon- 2, RTN2 ELISA KIT

ELI-36391h 96 Tests
EUR 824

Human Reticulon- 3, RTN3 ELISA KIT

ELI-41269h 96 Tests
EUR 824

Human Reticulon 2 (RTN2) ELISA Kit

abx382990-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Reticulon 3 (RTN3) ELISA Kit

abx382991-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Reticulon 3(RTN3)ELISA Kit

QY-E01105 96T
EUR 361

Human Reticulon 2(RTN2)ELISA Kit

QY-E01106 96T
EUR 361

Human Reticulon 1(RTN1)ELISA Kit

QY-E01107 96T
EUR 361

Mouse RTN4R PicoKine ELISA Kit

EK2066 96 wells
EUR 425
Description: For quantitative detection of mouse RTN4R in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rtn4r ELISA Kit (Mouse) (OKBB01433)

OKBB01433 96 Wells
EUR 505
Description: Description of target: Reticulon 4 receptor (RTN4R) also known as Nogo-66 Receptor (NgR) or Nogo receptor 1 is a protein which in humans is encoded by the RTN4R gene. It is mapped to 16; 16 A3. This gene encodes the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Reticulon 4 Interacting Protein 1 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

ELI-29470h 96 Tests
EUR 824


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RTN4R antibody

70R-51087 100 ul
EUR 244
Description: Purified Polyclonal RTN4R antibody

RTN4R Antibody

33085-100ul 100ul
EUR 252

RTN4R antibody

70R-20040 50 ul
EUR 435
Description: Rabbit polyclonal RTN4R antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RTN4R Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human. This antibody is Unconjugated. Tested in the following application: ELISA

RTN4R Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

RTN4R Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC


PVT12203 2 ug
EUR 391

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-48Tests 48 Tests
EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RD-CA72-4-Hu-96Tests 96 Tests
EUR 662

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692

Mouse Reticulon- 3, Rtn3 ELISA KIT

ELI-21595m 96 Tests
EUR 865

Mouse Reticulon- 2, Rtn2 ELISA KIT

ELI-38724m 96 Tests
EUR 865

Bovine Reticulon- 3, RTN3 ELISA KIT

ELI-41268b 96 Tests
EUR 928

Human RTN4R shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RTN4R Recombinant Protein (Human)

RP027400 100 ug Ask for price

RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein

PROTQ8WWV3 Regular: 20ug
EUR 317
Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody

abx122325-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human FibrOut 4, for brain, neural

4-21552 1 ml Ask for price

Human FibrOut 4, for brain, neural

4-21553 5 x 1 ml Ask for price

Recombinant Human PF-4 (CXCL4) Protein

PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

RTN4R Conjugated Antibody

C33085 100ul
EUR 397

RTN4R Polyclonal Antibody

ES11347-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTN4R Polyclonal Antibody

ES11347-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RTN4R Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RTN4R Polyclonal Antibody

ABP60283-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RTN4R from Human. This RTN4R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350

RTN4R Polyclonal Antibody

ABP60283-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RTN4R from Human. This RTN4R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350

RTN4R Polyclonal Antibody

ABP60283-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RTN4R from Human. This RTN4R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350

RTN4R Rabbit pAb

A5847-100ul 100 ul
EUR 308

RTN4R Rabbit pAb

A5847-200ul 200 ul
EUR 459

RTN4R Rabbit pAb

A5847-20ul 20 ul
EUR 183

RTN4R Rabbit pAb

A5847-50ul 50 ul
EUR 223

RTN4R cloning plasmid

CSB-CL880152HU-10ug 10ug
EUR 507
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1422
  • Sequence: atgaagagggcgtccgctggagggagccggctgctggcatgggtgctgtggctgcaggcctggcaggtggcagccccatgcccaggtgcctgcgtatgctacaatgagcccaaggtgacgacaagctgcccccagcagggcctgcaggctgtgcccgtgggcatccctgctgcca
  • Show more
Description: A cloning plasmid for the RTN4R gene.

Anti-RTN4R antibody

STJ28410 100 µl
EUR 277
Description: This gene encodes the receptor for reticulon 4, oligodendrocyte myelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.

Anti-RTN4R antibody

STJ192505 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RTN4R

Human RTN4R(Reticulon 4 Receptor) ELISA Kit