Human THOP1(Thimet Oligopeptidase 1) ELISA Kit

Human THOP1(Thimet Oligopeptidase 1) ELISA Kit

Contact us: [email protected]

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

RDR-THOP1-Hu-48Tests 48 Tests
EUR 544

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

RDR-THOP1-Hu-96Tests 96 Tests
EUR 756

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

RD-THOP1-Hu-48Tests 48 Tests
EUR 521

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

RD-THOP1-Hu-96Tests 96 Tests
EUR 723

Thimet Oligopeptidase (THOP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thimet Oligopeptidase (THOP1) Antibody

abx122858-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Thimet Oligopeptidase (THOP1) Antibody

abx238671-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human THOP1/ Thimet oligopeptidase ELISA Kit

E2493Hu 1 Kit
EUR 605

Human THOP1(Thimet oligopeptidase) ELISA Kit

EH1476 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P52888
  • Alias: THOP1/Thimet oligopeptidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Thimet oligopeptidase, THOP1 ELISA KIT

ELI-04309h 96 Tests
EUR 824

Human Thimet Oligopeptidase (THOP1) ELISA Kit

abx250757-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thimet Oligopeptidase 1(THOP1)ELISA Kit

QY-E04540 96T
EUR 361

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

SEH027Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thimet Oligopeptidase 1 (THOP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thimet Oligopeptidase 1 (THOP1) in Tissue homogenates and other biological fluids.

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

SEH027Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thimet Oligopeptidase 1 (THOP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thimet Oligopeptidase 1 (THOP1) in Tissue homogenates and other biological fluids.

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

SEH027Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thimet Oligopeptidase 1 (THOP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thimet Oligopeptidase 1 (THOP1) in Tissue homogenates and other biological fluids.

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

SEH027Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thimet Oligopeptidase 1 (THOP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thimet Oligopeptidase 1 (THOP1) in Tissue homogenates and other biological fluids.

Human Thimet Oligopeptidase 1 (THOP1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thimet Oligopeptidase 1 elisa. Alternative names of the recognized antigen: EP24.15
  • MP78
  • Endopeptidase 24.15
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thimet Oligopeptidase 1 (THOP1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Thimet Oligopeptidase 1 (THOP1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thimet Oligopeptidase 1 (THOP1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thimet Oligopeptidase 1 (THOP1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Thimet Oligopeptidase 1 (THOP1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52888
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.5kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Thimet Oligopeptidase 1 expressed in: E.coli

Human Thimet Oligopeptidase 1 (THOP1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cow Thimet Oligopeptidase (THOP1) ELISA Kit

abx516300-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Thimet Oligopeptidase (THOP1) ELISA Kit

abx516302-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig Thimet Oligopeptidase (THOP1) ELISA Kit

abx516303-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Thimet Oligopeptidase (THOP1) ELISA Kit

abx516304-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Thop1/ Thimet oligopeptidase ELISA Kit

E1468Mo 1 Kit
EUR 632

Bovine Thimet oligopeptidase, THOP1 ELISA KIT

ELI-04308b 96 Tests
EUR 928

Porcine Thimet oligopeptidase, THOP1 ELISA KIT

ELI-04310p 96 Tests
EUR 928

Mouse Thimet oligopeptidase, Thop1 ELISA KIT

ELI-04312m 96 Tests
EUR 865

Human Thimet Oligopeptidase 1 (THOP1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human THOP1 (Thimet Oligopeptidase 1)

ELK4817 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thimet Oligopeptidase 1 (THOP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Th
  • Show more
Description: A sandwich ELISA kit for detection of Thimet Oligopeptidase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Thop1 ELISA Kit| Rat Thimet oligopeptidase ELISA Kit

EF019409 96 Tests
EUR 689

Thop1 ELISA Kit| Mouse Thimet oligopeptidase ELISA Kit

EF016372 96 Tests
EUR 689

THOP1 ELISA Kit| Bovine Thimet oligopeptidase ELISA Kit

EF011969 96 Tests
EUR 689

Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)

C179-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.

Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)

C179-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.

Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)

C179-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.

Recombinant Human Thimet Oligopeptidase/THOP1 (C-6His)

C179-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 100mM NaCl, 10% Glycerol, pH 7.0.

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1)

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with APC.

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with Biotin.

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with Cy3.

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with FITC.

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with HRP.

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with PE.

Thimet Oligopeptidase Antibody

35415-100ul 100ul
EUR 390

Thimet Oligopeptidase 1 (THOP1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THOP1 (Asn451~Thr597)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Thimet Oligopeptidase 1 (THOP1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Thimet oligopeptidase

EK3161 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thimet oligopeptidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Anti-Thimet Oligopeptidase (2B4)

YF-MA15846 200 ul
EUR 363
Description: Mouse monoclonal to Thimet Oligopeptidase

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Thop1/ Rat Thop1 ELISA Kit

ELI-04311r 96 Tests
EUR 886


ELA-E13023h 96 Tests
EUR 824


EF005171 96 Tests
EUR 689

THOP1 ELISA Kit (Human) (OKCD09023)

OKCD09023 96 Wells
EUR 975
Description: Description of target: The function of this protein remains unknown.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.63ng/mL

THOP1 ELISA Kit (Human) (OKEH02284)

OKEH02284 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.13 ng/mL

THOP1 ELISA Kit (Mouse) (OKEH05571)

OKEH05571 96 Wells
EUR 779
Description: Description of target: Involved in the metabolism of neuropeptides under 20 amino acid residues long. Involved in cytoplasmic peptide degradation. Able to degrade the beta-amyloid precursor protein and generate amyloidogenic fragments.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL

THOP1 ELISA Kit (Bovine) (OKEH07898)

OKEH07898 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

THOP1 ELISA Kit (Pig) (OKEH07899)

OKEH07899 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

THOP1 antibody

70R-20813 50 ul
EUR 435
Description: Rabbit polyclonal THOP1 antibody

THOP1 Antibody

47258-100ul 100ul
EUR 252

THOP1 antibody

10R-6062 100 ul
EUR 726
Description: Mouse monoclonal THOP1 antibody

THOP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against THOP1. Recognizes THOP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


PVT18397 2 ug
EUR 258

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human THOP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

THOP1 Recombinant Protein (Human)

RP031498 100 ug Ask for price

THOP1 Recombinant Protein (Human)

RP031501 100 ug Ask for price

THOP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2370702 1.0 ug DNA
EUR 154

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

THOP1 Conjugated Antibody

C47258 100ul
EUR 397

THOP1 cloning plasmid

CSB-CL023508HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2070
  • Sequence: atgaagccccccgcagcctgtgcaggagacatggcggacgcagcatctccgtgctctgtggtaaacgacctgcggtgggacctgagtgcccagcagatagaggagcgcaccagggagctcatcgagcagaccaagcgcgtgtatgaccaggttggcacccaggagtttgaggacg
  • Show more
Description: A cloning plasmid for the THOP1 gene.

THOP1 cloning plasmid

CSB-CL023508HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2070
  • Sequence: atgaagccccccgcagcctgtgcaggagacatggcggacgcagcatctccgtgctctgtggtaaacgacctgcggtgggacctgagtgcccagcagatagaggagcgcaccagggagctcatcgagcagaccaagcgcgtgtatgaccaggttggcacccaggagtttgaggacg
  • Show more
Description: A cloning plasmid for the THOP1 gene.

THOP1 Polyclonal Antibody

ES11004-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against THOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

THOP1 Polyclonal Antibody

ES11004-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against THOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- THOP1 antibody

FNab08671 100µg
EUR 548.75
  • Immunogen: thimet oligopeptidase 1
  • Uniprot ID: P52888
  • Gene ID: 7064
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against THOP1

THOP1 Polyclonal Antibody

ABP60676-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein

THOP1 Polyclonal Antibody

ABP60676-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein

THOP1 Polyclonal Antibody

ABP60676-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human THOP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of THOP1 from Human, Mouse, Rat. This THOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THOP1 protein

THOP1 Rabbit pAb

A8756-100ul 100 ul
EUR 308

THOP1 Rabbit pAb

A8756-200ul 200 ul
EUR 459

THOP1 Rabbit pAb

A8756-20ul 20 ul
EUR 183

THOP1 Rabbit pAb

A8756-50ul 50 ul
EUR 223

Anti-THOP1 antibody

PAab08671 100 ug
EUR 386


PVT14316 2 ug
EUR 495

Anti-THOP1 antibody

STJ111402 100 µl
EUR 277
Description: The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides.

Anti-THOP1 antibody

STJ192162 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to THOP1

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

THOP1 ORF Vector (Human) (pORF)

ORF010500 1.0 ug DNA
EUR 95

THOP1 ORF Vector (Human) (pORF)

ORF010501 1.0 ug DNA
EUR 95


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse THOP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat THOP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

THOP1 Recombinant Protein (Rat)

RP233045 100 ug Ask for price

THOP1 Recombinant Protein (Mouse)

RP178619 100 ug Ask for price

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Thop1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4959602 1.0 ug DNA
EUR 154

Thop1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7008502 1.0 ug DNA
EUR 154

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

THOP1 sgRNA CRISPR Lentivector set (Human)

K2370701 3 x 1.0 ug
EUR 339

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

EI2301-1 96 Well Plate
EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

EP1100-1 96 Well Plate
EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit

EG2350-1 96 Well Plate
EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit

EG3928-1 96 Well Plate
EUR 477

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit

EC5752-1 96 Well Plate
EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5001-1 96 Well Plate
EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5101-1 96 Well Plate
EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit

EA5501-1 96 Well Plate
EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit

EE2702-1 96 Well Plate
EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit

EM5110-1 96 Well Plate
EUR 396

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Human THOP1(Thimet Oligopeptidase 1) ELISA Kit