Human PANX1(Pannexin 1) ELISA Kit

Human PANX1(Pannexin 1) ELISA Kit

Contact us: [email protected]

Human Pannexin-1 (PANX1) ELISA Kit

RD-PANX1-Hu-48Tests 48 Tests
EUR 521

Human Pannexin-1 (PANX1) ELISA Kit

RD-PANX1-Hu-96Tests 96 Tests
EUR 723

Human Pannexin 1 (PANX1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Pannexin-1 (PANX1) ELISA Kit

abx250546-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human PANX1/ Pannexin-1 ELISA Kit

E1864Hu 1 Kit
EUR 605

Human PANX1(Pannexin-1) ELISA Kit

EH1283 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96RD7
  • Alias: PANX1(Pannexin-1)/Innexin/MRS1/PX1/pannexin 1/UNQ2529
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Pannexin- 1, PANX1 ELISA KIT

ELI-12426h 96 Tests
EUR 824

Human Pannexin 1(PANX1)ELISA Kit

QY-E04710 96T
EUR 361

Human Pannexin 1 ELISA Kit (PANX1)

RK02015 96 Tests
EUR 521

Human Pannexin 1 (PANX1) ELISA Kit

SEE788Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pannexin 1 (PANX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pannexin 1 (PANX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pannexin 1 (PANX1) ELISA Kit

SEE788Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pannexin 1 (PANX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pannexin 1 (PANX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pannexin 1 (PANX1) ELISA Kit

SEE788Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pannexin 1 (PANX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pannexin 1 (PANX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pannexin 1 (PANX1) ELISA Kit

SEE788Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pannexin 1 (PANX1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pannexin 1 (PANX1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pannexin 1 (PANX1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Pannexin 1 elisa. Alternative names of the recognized antigen: MRS1
  • PX1
  • Innexin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pannexin 1 (PANX1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Panx1/ Pannexin-1 ELISA Kit

E0725Ra 1 Kit
EUR 646

Mouse Panx1/ Pannexin-1 ELISA Kit

E1096Mo 1 Kit
EUR 632

Mouse Pannexin- 1, Panx1 ELISA KIT

ELI-43227m 96 Tests
EUR 865

Mouse Pannexin-1 (PANX1) ELISA Kit

abx515359-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Pannexin-1 (PANX1) ELISA Kit

abx515360-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pannexin-1 (PANX1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pannexin 1 (PANX1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pannexin 1 (PANX1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pannexin-1 (PANX1) Antibody

abx029290-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Pannexin-1 (PANX1) Antibody

abx029290-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pannexin-1 (PANX1) Antibody

abx236137-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Pannexin 1 (PANX1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Pannexin 1 (PANX1)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96RD7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.5kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Pannexin 1 expressed in: E.coli

Recombinant Pannexin 1 (PANX1)

  • EUR 526.50
  • EUR 244.00
  • EUR 1699.36
  • EUR 633.12
  • EUR 1166.24
  • EUR 415.00
  • EUR 4098.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P60570
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Pannexin 1 expressed in: E.coli

ELISA kit for Human PANX1 (Pannexin 1)

ELK4985 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pannexin 1 (PANX1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pannexin 1 (PAN
  • Show more
Description: A sandwich ELISA kit for detection of Pannexin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Pannexin-1 (PANX1)

KTE61308-48T 48T
EUR 332
  • Pannexin 1 belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Pannexin-1 (PANX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pannexin-1 (PANX1)

KTE61308-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Pannexin 1 belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Pannexin-1 (PANX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pannexin-1 (PANX1)

KTE61308-96T 96T
EUR 539
  • Pannexin 1 belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. S
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Pannexin-1 (PANX1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Pannexin 1 (PANX1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Pannexin 1 (PANX1) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Panx1 ELISA Kit| Rat Pannexin-1 ELISA Kit

EF019132 96 Tests
EUR 689

Panx1 ELISA Kit| Mouse Pannexin-1 ELISA Kit

EF015788 96 Tests
EUR 689

Rat Pannexin 1 (PANX1) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Pannexin 1 (PANX1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pannexin 1 (PANX1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pannexin 1 (PANX1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pannexin 1 (PANX1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1)

Pannexin 1 (PANX1) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1)

Human pannexin 1 (Panx1) Control/blocking peptide

AB-23017-P 100ug
EUR 164

Pannexin 1 (PANX1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with APC.

Pannexin 1 (PANX1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with Biotin.

Pannexin 1 (PANX1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with Cy3.

Pannexin 1 (PANX1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with FITC.

Pannexin 1 (PANX1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with HRP.

Pannexin 1 (PANX1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with PE.

Pannexin 1 (PANX1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Cys228~Asn411)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pannexin 1 (PANX1). This antibody is labeled with APC-Cy7.

Mouse pannexin 1 (Panx1) Control/blocking peptide

AB-23016-P 100ug
EUR 164

Mouse pannexin 1 (Panx1) Control/blocking peptide

AB-23246-P 100ug
EUR 164

Mouse pannexin 1 (Panx1) Control/blocking peptide

AB-23247-P 100ug
EUR 164

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with APC.

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with Biotin.

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with Cy3.

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with FITC.

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with HRP.

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Rabbit Anti-Human pannexin 1 (Panx1) IgG (aff pure)

AB-23017-A 100ug
EUR 482

Pannexin 1 (PANX1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PANX1 (Ala77~Asp260)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pannexin 1 (PANX1). This antibody is labeled with APC-Cy7.

Rabbit Anti-Mouse pannexin 1 (Panx1) IgG (aff pure

AB-23016-A 100ug
EUR 482

Rabbit Anti-Mouse pannexin 1 (Panx1) IgG (aff pure)

AB-23246-A 100ug
EUR 482

Rabbit Anti-Mouse pannexin 1 (Panx1) IgG (aff pure)

AB-23247-A 100ug
EUR 482

Panx1/ Rat Panx1 ELISA Kit

ELI-35397r 96 Tests
EUR 886


ELA-E11281h 96 Tests
EUR 824


EF003463 96 Tests
EUR 689

ELISA kit for Human Pannexin-1

EK2807 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Pannexin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

PANX1 ELISA Kit (Human) (OKAN05718)

OKAN05718 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL

PANX1 ELISA Kit (Human) (OKCD08708)

OKCD08708 96 Wells
EUR 975
Description: Description of target: PANX1 belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties.The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL

Anti-Pannexin 2/PANX2 Antibody

A08860-1 100ug/vial
EUR 294

Pannexin 1 antibody

70R-6579 50 ug
EUR 467
Description: Rabbit polyclonal Pannexin 1 antibody raised against the middle region of PANX1

Human Pannexin- 2, PANX2 ELISA KIT

ELI-21832h 96 Tests
EUR 824

Human Pannexin- 3, PANX3 ELISA KIT

ELI-44899h 96 Tests
EUR 824

Human Pannexin 3(PANX3)ELISA Kit

QY-E04708 96T
EUR 361

Human Pannexin 2(PANX2)ELISA Kit

QY-E04709 96T
EUR 361

PANX1 ELISA Kit (Mouse) (OKEH05669)

OKEH05669 96 Wells
EUR 779
Description: Description of target: Structural component of the gap junctions and the hemichannels. May play a role as a Ca2+-leak channel to regulate ER Ca2+ homeostasis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

Pannexin 1 Blocking Peptide

33R-5005 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PANX1 antibody, catalog no. 70R-6579

Pannexin - 1 Fragment (4512)

5-01713 4 x 5mg Ask for price

Pannexin - 1 Fragment (4515)

5-01714 4 x 5mg Ask for price

Pannexin 1 Polyclonal Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal Pannexin 1 Antibody

APR12713G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Pannexin 1 . This antibody is tested and proven to work in the following applications:

Anti-Pannexin 1 (2E3)

YF-MA17987 100 ug
EUR 363
Description: Mouse monoclonal to Pannexin 1

PANX1 ELISA Kit (Human) : 96 Wells (OKEH02152)

OKEH02152 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

PANX1 antibody

70R-19108 50 ul
EUR 435
Description: Rabbit polyclonal PANX1 antibody

PANX1 antibody

39097-100ul 100ul
EUR 252

PANX1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANX1. Recognizes PANX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:200-1:500

PANX1 Antibody

DF8316 200ul
EUR 304
Description: PANX1 Antibody detects endogenous levels of total PANX1.

PANX1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PANX1. Recognizes PANX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PANX1 Antibody

ABD8316 100 ug
EUR 438

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Mouse Pannexin- 3, Panx3 ELISA KIT

ELI-14687m 96 Tests
EUR 865

Mouse Pannexin- 2, Panx2 ELISA KIT

ELI-45097m 96 Tests
EUR 865

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Recombinant human Pannexin-3

P2281 100ug Ask for price
  • Uniprot ID: Q96QZ0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Pannexin-3

Recombinant human Pannexin-2

P2671 100ug Ask for price
  • Uniprot ID: Q96RD6
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Pannexin-2

Human PANX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PANX1 Recombinant Protein (Human)

RP022513 100 ug Ask for price

Pannexin 1 Fragment (4515) Peptide

  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Pannexin 1 Fragment (4512) Peptide

  • EUR 523.00
  • EUR 871.00
  • EUR 384.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

PANX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1591802 1.0 ug DNA
EUR 154

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PANX1 Western Blot kit (AWBK42783)

AWBK42783 10 reactions
EUR 647
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Pannexin 2 antibody

70R-1761 100 ug
EUR 377
Description: Rabbit polyclonal Pannexin 2 antibody raised against the N terminal of PANX2

Pannexin-3 Antibody

45115-100ul 100ul
EUR 252

Pannexin-3 Antibody

45115-50ul 50ul
EUR 187

Pannexin-3 Antibody

DF7721 200ul
EUR 304
Description: Pannexin-3 Antibody detects endogenous levels of total Pannexin-3.

Pannexin 3 antibody

70R-7072 50 ug
EUR 467
Description: Rabbit polyclonal Pannexin 3 antibody raised against the middle region of PANX3

Pannexin- 3 Antibody

ABD7721 100 ug
EUR 438

PANX1 Rabbit pAb

A13587-100ul 100 ul
EUR 308

PANX1 Rabbit pAb

A13587-200ul 200 ul
EUR 459

PANX1 Rabbit pAb

A13587-20ul 20 ul
EUR 183

PANX1 Rabbit pAb

A13587-50ul 50 ul
EUR 223

PANX1 Antibody (NT)

EUR 403

PANX1 Blocking Peptide

DF8316-BP 1mg
EUR 195

Polyclonal PANX1 Antibody

APR12716G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANX1 . This antibody is tested and proven to work in the following applications:

PANX1 Conjugated Antibody

C39097 100ul
EUR 397

PANX1 cloning plasmid

CSB-CL857017HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggccatcgctcacctggccacggagtacgtgttctcggatttcttgctgaaggagcccacggagcccaagttcaaggggctgcgactggagctggctgtggacaagatggtcacgtgcattgcggtggggctgcccctgctgctcatctcgctggccttcgcgcaggagatct
  • Show more
Description: A cloning plasmid for the PANX1 gene.

PANX1 Rabbit pAb

A6683-100ul 100 ul
EUR 308

PANX1 Rabbit pAb

A6683-200ul 200 ul
EUR 459

PANX1 Rabbit pAb

A6683-20ul 20 ul
EUR 183

PANX1 Rabbit pAb

A6683-50ul 50 ul
EUR 223

anti- PANX1 antibody

FNab06137 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: pannexin 1
  • Uniprot ID: Q96RD7
  • Gene ID: 24145
  • Research Area: Signal Transduction
Description: Antibody raised against PANX1

Anti-PANX1 antibody

PAab06137 100 ug
EUR 412

Anti-PANX1 antibody

STJ28766 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties.

Anti-PANX1 antibody

STJ115548 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties.

Anti-PANX1 Antibody

STJ502101 100 µg
EUR 476

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PANX1 ORF Vector (Human) (pORF)

ORF007505 1.0 ug DNA
EUR 95


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human PANX1(Pannexin 1) ELISA Kit